Epidemiological assessment of cassava mosaic disease in Burkina Faso

Received: 6 April 2021 | Accepted: 5 August 2021 

DOI: 10.1111/ppa.13459  

ORIGINAL ARTICLE 

Epidemiological assessment of cassava mosaic disease in  Burkina Faso 

Monique Soro1,2,3,4 | Fidèle Tiendrébéogo1,3,4 | Justin S. Pita1,2 |  Edwig T. Traoré3,4,5 | Koussao Somé3,4,6 | Ezechiel B. Tibiri3,4 | James B. Néya3,4 |  J. Musembi Mutuku1 | Jacques Simporé5 | Daouda Koné2,7 

1Central and West African Virus  Epidemiology (WAVE), Pôle scientifique  et d’innovation de Bingerville, Université  Félix Houphouët-Boigny (UFHB),  Bingerville, Ivory Coast 

2Laboratoire de Biotechnologie, Agriculture  et Valorisation des Ressources Biologiques,  UFR Biosciences, Université Félix  Houphouët-Boigny, Abidjan, Ivory Coast 3Laboratoire de Virologie et de  

Biotechnologies Végétales, Institut de  l’Environnement et de Recherches Agricoles  (INERA), Ouagadougou, Burkina Faso 4Laboratoire Mixte International Patho-Bios,  IRD-INERA, Ouagadougou, Burkina Faso 5Laboratoire de Biologie Moléculaire et de  Génétique (LABIOGENE), Université Joseph  Ki-Zerbo, Ouagadougou, Burkina Faso 6Laboratoire de Génétique et de  

Biotechnologies Végétales, Institut de  l’Environnement et de Recherches Agricoles  (INERA), Ouagadougou, Burkina Faso 7Centre d’Excellence Africain sur le  Changement Climatique, la Biodiversité  et l’Agriculture Durable (WASCAL/CEA CCBAD, Université Félix Houphouët Boigny), PSI-Université Félix Houphouët Boigny, Abidjan, Ivory Coast 

Correspondence 

Fidèle Tiendrébéogo, Laboratoire de  Virologie et de Biotechnologies Végétales,  Institut de l’Environnement et de  Recherches Agricoles (INERA), 01 BP 476  Ouagadougou 01, Burkina Faso. 

Emails: fidelet@gmail.com; fidele. tiendrebeogo@wave-center.org 

Funding information 

Bill & Melinda Gates Foundation; The  United Kingdom Foreign, Commonwealth  & Development Office, Grant/Award  Number: OPP1082413 

Abstract 

Surveys were conducted in 2016 and 2017 across the main cassava-growing regions  of Burkina Faso to assess the status of cassava mosaic disease (CMD) and to determine  the virus strains causing the disease, using field observation and phylogenetic analy sis. CMD incidence varied between regions and across years but was lowest in Hauts Bassins (6.0%, 2016 and 5.4%, 2017) and highest in Centre-Sud (18.5%, 2016) and in  Boucle du Mouhoun (51.7%, 2017). The lowest CMD severity was found in Est region  (2.0) for both years and the highest in Sud-Ouest region (3.3, 2016) and Centre-Sud  region (2.8, 2017). The CMD infection was primarily associated with contaminated  cuttings in all regions except in Hauts-Bassins, where whitefly-borne infection was  higher than cuttings-borne infection in 2016. PCR screening of 687 samples coupled  with sequence analysis revealed the presence of African cassava mosaic-like (ACMV like) viruses and East African cassava mosaic-like (EACMV-like) viruses as single infec tions at 79.5% and 1.1%, respectively. Co-infections of ACMV-like and EACMV-like  viruses were detected in 19.4% of the tested samples. In addition, 86.7% of the sam ples positive for EACMV-like virus were found to be positive for East African cassava  mosaic Cameroon virus (EACMCMV). Phylogenetic analysis revealed the segregation  of cassava mosaic geminiviruses (CMGs) from Burkina Faso into three clades specific  to ACMV, African cassava mosaic Burkina Faso virus (ACMBFV), and EACMCMV, con firming the presence of these viruses. The results of this study show that EACMCMV  occurrence may be more prevalent in Burkina Faso than previously thought. 

KEYWORDS 

African cassava mosaic virus (ACMV), cassava mosaic geminiviruses, East African cassava  mosaic Cameroon virus (EACMCMV), geminiviruses characterization, geminiviruses  distribution

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,  provided the original work is properly cited. 

© 2021 The Authors. Plant Pathology published by John Wiley & Sons Ltd on behalf of British Society for Plant Pathology. 

Plant Pathology. 2021;70:2207–2216. wileyonlinelibrary.com/journal/ppa | 2207 

2208 |    SORO et al. 

1  | INTRODUCTION 

Cassava (Manihot esculenta, Euphorbiaceae), which originates from  Latin America, is a major source of food for more than 700 million  people in tropical and subtropical developing countries and en hances food security in these countries (Ntawuruhunga et al., 2013;  Patil & Fauquet, 2009; Saediman et al., 2016). Cassava is a staple  food crop in the sub-Saharan region of Africa and consequently a  source of income for many processors and traders (Ntawuruhunga  et al., 2013). The high calorie yield per hectare (250 kcal/ha/day),  drought tolerance, hardiness in stressful environments, and flexibil ity of harvesting time are the major advantages of this crop com pared to many other crops (Byju & Suja, 2020; El-Sharkawy, 2004;  Pushpalatha & Gangadharan, 2020). In Burkina Faso, cassava was  introduced by farmers decades ago from Ghana and Ivory Coast  (Côte d’Ivoire) (Guira et al., 2017). It has long been cultivated around  vegetable gardens for domestic consumption. Formerly considered  as a neglected crop, cassava has become a cash crop since the for mal introduction of improved varieties from IITA in 2003 (Dabiré &  Belem, 2003). 

In Africa, cassava production is negatively affected by two main  viral diseases: cassava brown streak disease (CBSD) and cassava mo saic disease (CMD). CMD is a major constraint to cassava production,  which causes tuber yield losses estimated at $2.7 billion annually  (Patil & Fauquet, 2009). CMD is caused by distinct cassava mosaic  geminiviruses (CMGs) (family Geminiviridae, genus Begomovirus) and  naturally transmitted by the whitefly Bemisia tabaci (Hemiptera:  Aleyrodidae) (Ally et al., 2019; Legg et al., 2002; MacFadyen et al.,  2018). CMD is also widely disseminated by infected stem cuttings,  used for vegetative propagation (Bock & Woods, 1983; Fondong  et al., 2000). CMD is endemic in Africa, with nine distinct CMG  species officially recognized by the International Committee on  Taxonomy of Viruses (ICTV; https://talk.ictvonline.org/ictv-repor 

ts/ictv_online_report/ssdna-viruses/w/geminiviridae/479/membe r-species-begomovirus): African cassava mosaic Burkina Faso virus  (ACMBFV; Tiendrébéogo et al., 2012), African cassava mosaic virus  (ACMV; Stanley & Gay, 1983), East African cassava mosaic Cameroon  virus (EACMCMV; Fondong et al., 2000), East African cassava mo saic Kenya virus (EACMKV; Bull et al., 2006), East African cassava  mosaic Malawi virus (EACMMV; Zhou et al., 1998), East African  cassava mosaic virus (EACMV; Pita, Fondong, Sangaré, Otim-Nape,  et al., 2001), East African cassava mosaic Zanzibar virus (EACMZV;  Maruthi et al., 2004), cassava mosaic Madagascar virus (CMMGV),  and South African cassava mosaic virus (SACMV; Berrie et al., 2001). 

In West Africa, the presence of ACMV and EACMV was reported  in Ivory Coast (Pita, Fondong, Sangaré, Kokora, et al., 2001; Toualy  et al., 2014), Ghana (Torkpo et al., 2017), and Nigeria (Abubakar  et al., 2019; Ariyo et al., 2005; Eni et al., 2021; Ogbe et al., 2006). The  presence of EACMCMV was also reported in Ivory Coast and Nigeria  (Ariyo et al., 2005; Eni et al., 2021; Pita, Fondong, Sangaré, Kokora,  et al., 2001). In previous studies, the presence of cassava mosaic dis 

ease (CMD) has been reported in some localities in Burkina Faso.  Indeed, the presence of ACMV was reported in 1995 using the triple  

antibody sandwich-ELISA method with cross-reacting monoclonal  antibodies to ACMV (Konaté et al., 1995). The molecular features  of an ACMV-like virus (ACMBFV, whose Rep protein gene and in tergenic region differ from ACMV) was described and the pres ence of EACMV-UG variant was reported around Ouagadougou  (Tiendrébéogo et al., 2009, 2012). Since then, the real status of CMD  and its epidemiological parameters such as the incidence and sever ity of the disease, the whitefly abundance, and the mode of infection  remain unclear. To overcome this knowledge gap, we conducted for  the first time georeferenced surveys in the main cassava production  areas in Burkina Faso. 

2  |  MATERIALS AND METHODS 

2.1  |  Cassava mosaic disease status assessment 

Surveys were conducted in 2016 and 2017 in eight major cassava growing regions of Burkina Faso (Figure 1). The number of fields  sampled within a region depended on the number of cassava growing localities and the availability of cassava fields at 3–6 months  after planting (MAP). Our field sampling protocol was a modification  of one previously described (Sseruwagi et al., 2004) and has been  adopted by 10 countries in Central and West Africa to harmonize ef forts at surveillance and monitoring of these transboundary patho gens of high economic importance. Briefly, in each field, 30 cassava  plants were assessed randomly along two diagonals to form an “X”  pattern. Then each selected plant was assessed visually for the pres ence or absence of CMD symptoms (leaf mosaic, leaf distortion, and  stunted growth) and the number of whiteflies settling on the leaves,  and if infected, we determined whether the mode of infection was  through cuttings or whitefly transmission. The whitefly popula tion was estimated by counting the number of whiteflies on the  top five fully expanded leaves. The mode of infection in each plant  was determined based on the location of the leaves with symptoms  as previously described by Sseruwagi et al. (2004). According to  these authors, from 3 to 6 MAP it is possible to distinguish between  cutting-borne and whitefly-borne infections. Symptoms appearing  only on upper leaves were taken to have resulted from whitefly transmitted infection, whereas plants that showed symptoms either  only on the lower leaves or on all leaves were taken as having been  infected through cassava cuttings. CMD symptom severity was re corded using a scale from 1 (no symptoms) to 5 (very severe symp toms) (Terry, 1975). We acknowledge that the severity level depends  on the variety, climate, crop management, and mainly the time at  which the infection occurred. To minimize the effects of these vari ables on our data, we sampled fields within the same locations that  were within the 3–6 MAP age. The CMD incidence was calculated  as the percentage of plants with symptoms in relation to the number  of plants assessed. 

A total of 237 leaf samples from 212 plants with symptoms and  25 without symptoms in 2016, and 450 leaf samples from 240 plants  with symptoms and 210 without symptoms in 2017 were collected 

   SORO et al. |  2209

FIGURE 1 Map of Burkina Faso showing the regions and localities where surveys were done in 2016 and 2017 [Colour figure can be  viewed at wileyonlinelibrary.com] 

TABLE 1 Primer pairs used for the amplification of ACMV-like virus, EACMV-like virus, and EACMCMV Expected  

Primer Sequence (5′–3′) Target region 

size (bp) Virus species Reference 

JSP 001 ATGTCGAAGCGACCAGGAGAT DNA-A (CP) 783 ACMV-like virus Pita, Fondong, Sangaré, Otim-Nape, et al.  (2001) JSP 002 TGTTTATTAATTGCCAATACT 

JSP 001 ATGTCGAAGCGACCAGGAGAT DNA-A (CP) 780 EACMV-like virus Pita, Fondong, Sangaré, Otim-Nape, et al.  (2001) JSP 003 CCTTTATTAATTTGTCACTGC 

VNF031/F GGATACAGATAGGGTTCCCAC DNA-A (AC2/ 

560 EACMCMV Fondong et al. (2000) 

VNF032/R GACGAGGACAAGAATTCCAAT

AC3) 

for laboratory analysis using PCR and Sanger sequencing. The global  positioning system (GPS) coordinates were recorded for each field. 

2.2  |  Molecular characterization of CMGs 

Total DNA was extracted from cassava leaves using the CTAB pro tocol as previously described (Permingeat et al., 1998). The concen tration of DNA in each sample was determined using a NanoDrop  2000 spectrophotometer (Thermo Fisher Scientific) and adjusted  to 150 ng/μl. We previously discovered that the most problematic  CMGs in smallholder cassava production in Burkina Faso were ACMV  and a variant of the East African cassava mosaic virus (EACMV), the  

EACMV-Uganda variant (Tiendrébéogo et al., 2009). Because the  current status of the incidence and severity of these two CMD causing viruses is unknown in Burkina Faso, we surveyed the whole  country and focused our surveys on ACMV and EACMV. The ex tracted DNA was subjected to PCR using the specific primers listed  in Table 1 for the detection of ACMV-like virus (JSP001/JSP002)  and EACMV-like virus (JSP001/JSP003). The samples positive for  EACMV-like virus were subjected to another round of PCR using  specific primers for the detection of EACMCMV (VNF031/VNF032;  Table 1). The PCR mix was prepared in a final volume of 25 μl using  20.9 μl of molecular biology grade water, 2.5 µl of 10× reaction  buffer, 0.5 µl of 10 mM dNTPs, 0.5 µl of 10 µM of each primer, 0.1 µl  of 5 U/µl of Maximo Taq DNA polymerase (GeneON), and 150 ng  

2210 |    SORO et al. 

DNA template of each sample. The DNA amplification was carried  out in a SimpliAmp thermal cycler (Life Technologies Holdings Pte  Ltd). The PCR temperature profile was set at 94°C for 4 or 5 min for  initial denaturation, followed by 35 cycles of amplification at 94°C  for 45 or 60 s, 55°C for 45 or 60 s, and 72°C for 55 or 60 s (depending  on primers). The final elongation step was performed at 72°C for 7  or 10 min. PCR-amplified products were subjected to 1% agarose gel  electrophoresis, stained with ethidium bromide. The electrophoresis  was performed at 100 V and the gel was visualized using a Compact  Digimage System, UVDI series (MS major science). PCR products of  40 ACMV-like positive samples (randomly selected from the regions)  were directly sequenced in both forward and reverse orientations  using the Sanger method at Inqaba Biotec company (South Africa)  to determine their identity. PCR products of 15 EACMCMV posi tive samples were also subjected to sequencing in both forward and  reverse orientations to confirm their identity. 

2.3  |  Statistical analysis 

Data analysis was performed using the R software v. 3.6.1 (R  Development Core Team). The normality of the variables was deter mined using the Shapiro–Wilk test. When the variable was not dis tributed according to the normal distribution, the generalized linear  model was used. The difference in the number of whiteflies per plant  between regions and the difference in the severity score of CMD  between regions in the same year were assessed using the general ized linear model and Tukey’s pairwise mean comparison test. The  difference in the number of whiteflies per plant and the difference  in the severity score of CMD between 2016 and 2017 were assessed  using Wilcoxon test with continuity correction. A test of pairwise  comparison of proportions was used based on a G-test with correc tion of BY (Benjamini & Yekutieli, 2001) to compare the incidences  of CMD between regions. The map of Burkina Faso showing the re gions where surveys were done in 2016 and 2017 was developed  using QGIS software v. 2.18.26 (https://qgis.org/downloads/). 

2.4  |  Phylogenetic analysis 

The amplicon sequences were trimmed and assembled de novo using  Geneious v. 8.1.7 (Biomatters Ltd) software. Consensus sequence  obtained from forward and reverse sequences for each sample was  subjected to BLASTn in NCBI for preliminary species assignment and  subsequently for pairwise sequence comparison (Bao et al., 2014).  The sequences were aligned with representative isolates of bego 

moviruses using ClustalW alignment method in MEGA X software  (Kumar et al., 2018). The sequences of 25 out of 40 ACMV-like virus  positive samples and six out of 15 EACMCMV positive samples were  used for phylogenetic tree construction. The maximum-likelihood  (ML) method with general time reversible (GTR) model (as the best  fit model for substitution pattern description) was used for phylo 

genetic trees construction using FastTree v. 2.1.9 (Price et al., 2010)  with bootstrap replicates of 1000. The tree was visualized and ed ited using FigTree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtr ee/). 

3  |  RESULTS 

3.1  |  CMD distribution in 2016 and 2017 

In 2016, CMD symptoms were found in 84.0% (42/50) of surveyed  localities, with the lowest proportion (57.1%, 8/14) of infected  fields in the region of Hauts-Bassins. Cassava fields in 65.9%  (29/44) of localities showed CMD symptoms in 2017, with the low 

est proportion (45.5%, 5/11) in Centre-Est region (Table 2). The  proportion of localities where CMD-affected cassava fields were  found varied significantly between 2016 and 2017 (p < 0.05).  Indeed, compared to 2016, no cassava fields were found to have  CMD symptoms in the provinces of Nahouri (Centre-Sud region)  and Bougouriba (Sud-Ouest region) in 2017. Typical CMD symp 

toms observed across farmers’ fields included distinctive leaf mo saic symptoms often associated with leaf distortion and reduction  

TABLE 2 Proportion of localities in Burkina Faso where typical cassava mosaic disease (CMD) symptoms were found on cassava plants in  2016 and 2017 

2016 2017 

Region 

Surveyed  localities 

Localities with  CMD 

Localities with  CMD (%) 

Surveyed  localities 

Localities with  CMD 

Localities with  CMD (%) 

Boucle du Mouhoun 5 4 80.0 2 2 100.0 Cascades 11 10 91.9 7 7 100.0 Centre-Est 1 1 100.0 11 5 45.4 Centre-Ouest 6 6 100.0 6 5 83.3 Centre-Sud 8 8 100.0 4 2 50.0 Est 2 2 100.0 2 2 100.0 Hauts-Bassins 14 8 57.1 8 4 50.0 Sud-Ouest 3 3 100.0 4 2 50.0 Total 50 42 84.0 44 29 65.9

   SORO et al. |  2211 

(Figure 2b–e), as well as an overall stunted appearance of the af fected plants. 

3.2  |  Incidence and symptom severity of CMD in  2016 and 2017 

The CMD incidence in 2016 varied significantly from that observed in  2017 (p ≤ 0.001). In 2016, the overall CMD incidence across the sur veyed fields in Burkina Faso was 11.3% (216/1920) and ranged from  6.0% (36/600) in Hauts-Bassins region to 18.5% (50/270) in Centre Sud region. In 2016, the difference between the lowest incidence  and the highest incidence was highly significant (p ≤ 0.001). For the  2017 survey, the overall CMD incidence was 18.9% (329/1720). The  lowest incidence in 2017 was observed in the Hauts-Bassins region  with 5.4% (21/390), whereas the Boucle du Mouhoun region was  observed to have the highest incidence 51.7% (30/60, p ≤ 0.001;  Figure 3a). 

The mean CMD symptom severity score was 2.9 and the range  was from 2.0 (Est region) to 3.3 (Sud-Ouest region) in 2016. In 2017,  the mean CMD symptom severity score was 2.5 with the lowest se verity in Est region (2.0) and the highest severity in the Centre-Sud  region (2.8) (Figure 3b). Significant differences (p < 0.05) were found  between CMD symptom severity scores in 2016 and 2017 in three  regions (Cascades, Centre-Ouest, and Hauts-Bassins). In most of the  regions, no significant difference was found between the proportion  of plants with different CMD symptom severity scores in 2016. In  2017, the proportion of plants with CMD symptom severity score 2.0  

was higher than the other symptom severity scores in most of the re gions, whereas in the region of Centre-Sud the proportion of plants  with CMD symptom severity score 3 was the highest (Figure 3c). 

3.3  |  Adult whitefly distribution and  

mode of infection 

Determination of whitefly counts and distribution was conducted  at the time of the CMD incidence and severity survey to ensure the  parameters that might affect the epidemiology of CMD in the field  were the same, and the plants were of similar age. The methods have  been harmonized across 10 West and Central African countries,  Sierra Leone, Ivory Coast, Burkina Faso, Ghana, Nigeria, Benin, Togo,  Cameroon, Gabon, and Democratic Republic of Congo, to ensure the  data is comparable. The adult whitefly counts were very low in 2016  and a similar trend was observed in 2017, with a mean of 0.1 and 0.7  per plant in 2016 and 2017, respectively. The highest mean whitefly  count was observed in the region of Boucle du Mouhoun (1.08) in  2016. In 2017, the highest mean whitefly count (2.7) was observed  in the regions of Boucle du Mouhoun and Cascades. In most of the  regions, the mean number of whiteflies per plant was higher in 2017  than in 2016 (Figure 3d). 

When the number of plants with symptoms infected through  cuttings or by whitefly transmission were compared, a prepon derance of cutting-borne infections was detected in 2016 (83.3%,  180/216) and 2017 (88.8%, 292/329). The exception was Hauts Bassins region, where greater whitefly-borne infections were  

FIGURE 2 Symptoms of cassava mosaic disease observed on infected cassava plants during the surveys, using a scale from 1 (no  symptoms) to 5 (very severe symptoms). (a) = 1, (b) = 2, (c) = 3, (d) = 4, (e) = 5 [Colour figure can be viewed at wileyonlinelibrary.com]

2212 |    SORO et al.

FIGURE 3 Epidemiological assessment of cassava mosaic disease (CMD) in Burkina Faso. (a) CMD incidence (percentage of plants with  symptoms). (b) Severity of CMD (mean CMD severity score of plants with symptoms). (c) Proportion of plants with different CMD severity  scores in 2016 and 2017. (d) Mean whitefly counts in 2016 and 2017. (e) Proportion of plants with symptoms infected by cutting or whitefly  in 2016 and 2017. The bars represent the standard error. Bars sharing the same lower case letters are not significantly different between  regions in 2016 and those sharing the same upper case letters are not significantly different between regions in 2017 [Colour figure can be  viewed at wileyonlinelibrary.com]

recorded in 2016 (Figure 3e). It is likely that a number of factors in cluding climatic conditions, infection status, or indeed cassava vari ety differences affected whitefly counts (Mugerwa et al., 2021). The  challenge is that during our survey years, whitefly pressure was not  strong enough to explain the significant differences in disease inci dence observed between regions and years. Also, considering that  high incidence is associated with seeding using infected cuttings, we  are not able to without doubt correlate whitefly numbers with the  disease incidence or severity. 

3.4  |  CMGs detected by PCR in cassava  leaf samples 

A total of 687 cassava leaf samples were collected from 452 plants  with symptoms and 235 plants without symptoms in 2016 and 2017  for PCR analysis. Among the samples having observable symptoms,  4.0% (18/452) tested negative for ACMV-like virus and EACMV-like  virus. On the other hand, 2.1% (5/235) of symptomless samples  tested positive for ACMV-like virus. Approximately 63.9% (439/687)  

   SORO et al. |  2213 TABLE 3 PCR results obtained from samples collected during 2016 and 2017 surveys in eight main cassava-growing regions of Burkina  Faso 

ACMV-like virus single  

infection 

Positive  

EACMV-like virus  

single infection Mixed infection 

Region Tested samples 

samples 

n % n % n % 

Boucle du Mouhoun 30 26 19 73.1 ad 0 0.0 7 26.9 ab Cascades 202 132 107 81.1 ab 3 2.3 22 16.6 bc Centre-Est 90 43 43 100.0 c 0 0.0 0 0.0 d Centre-Ouest 95 70 62 88.6 ab 0 0.0 8 11.4 bc Centre-Sud 84 68 38 55.9 d 1 1.5 29 42.6 a Est 35 18 18 100.0 c 0 0.0 0 0.0 d Hauts-Bassins 113 54 48 88.9 ab 0 0.0 0 11.1 bc Sud-Ouest 38 28 14 50.0 d 1 3.6 13 46.4 a Total 687 439 349 79.5 5 1.1 85 19.4 Note: Percentages followed by the same letters are not significantly different between regions.

of collected samples tested positive for CMGs. Among the positive  samples, the single ACMV-like virus infection was by far the most  frequent, accounting for 79.5% (349/439) of all infection, followed  by mixed infections of ACMV-like virus and EACMV-like virus with  19.4% (85/439), and single infection of EACMV-like virus with 1.1%  (5/439). The single infection of ACMV-like virus was predominant  in all surveyed regions, with the highest proportion (100%) in the  Centre-Est and Est regions. The mixed infection occurred in the  remaining six regions, with the highest proportions in Centre-Sud  (42.6%, 29/68) and Sud-Ouest (46.4%, 13/28) regions. The single in fection of EACMV-like virus was found in the regions of Sud-Ouest  (3.6%, 1/28), Cascades (2.3%, 3/132) and Centre-Sud (1.5%, 1/68)  but no significant difference was found between these proportions  (Table 3). Of the 90 EACMV-like virus positive samples (single and  mixed infections), 86.7% (78/90) tested positive for EACMCMV  using the primer pair VNF031/VNF032. 

3.5  |  CMGs identity confirmed by sequencing 

A search for related sequences in the GenBank database (NCBI,  BLASTN) showed that the sequences of the 40 samples that tested  positive for the ACMV-like virus were most closely related to ACMV  and ACMBFV. Indeed, they shared the highest nucleotide identity  (98%–99%) with ACMV isolates from Ghana (MG250119, MG250156,  MG250088), Ivory Coast (AF259894), Burkina Faso (FM877473),  and Nigeria (MH251339), and with ACMBFV isolates from Burkina  Faso (HE616777, HE616779, HE616780, HE616781). The sequences  of the 15 samples that tested positive for EACMCMV were most  closely related to the EACMCMV and shared the highest nucleotide  identities (97%–98%) with isolates from Ghana (MG250164), Ivory  Coast (AF259896), Nigeria (EU685319, EU685326), and Madagascar  (KJ887944). The ML phylogenetic tree inferred from alignment of  coat protein (CP) gene sequences from Burkina Faso (25 ACMV like virus and six EACMCMV) and other CMGs confirmed that the  

sequences from Burkina Faso are phylogenetically associated with  ACMV, ACMBFV, or EACMCMV (Figure 4). 

4  | DISCUSSION 

In general, the mean CMD severity scores recorded in the study  areas were moderate in both 2016 and 2017. This could be due to  similarities in factors affecting disease establishment across the  country. The significant difference observed between the propor 

tion of localities with CMD-affected fields in 2016 and 2017 could  be explained by better awareness by farmers of the risk of CMD  transmission via infected cuttings through outreach programmes  initiated in 2016. 

The relatively lower incidence recorded in Burkina Faso could  be explained by the fact that the intensification of cassava produc tion is a more recent phenomenon in the country compared to other  African countries (Guira et al., 2017; Legg et al., 2006), coupled with  CMD awareness and the adoption of good farming practices by  farmers. 

Our results showed that cases of CMD transmitted by cassava  cuttings were more prevalent as compared to cases resulting from  whitefly transmission. This phenomenon appears to be widespread  in sub-Saharan Africa (Chikoti et al., 2013; Mulenga et al., 2016;  Mwatuni et al., 2015; Torkpo et al., 2018; Zinga et al., 2013). The  high incidence of cutting-borne infection is probably due to farm 

ers’ inability to select virus-free cassava cuttings when planting. The  very low incidences of whitefly-borne infections observed in Burkina  Faso is consistent with the low counts of whiteflies observed in the  cassava fields in both years under study. It is notable that although  the mean whitefly counts in the Hauts-Bassins region was less than  one per plant in 2016, a higher proportion of whitefly-borne infec 

tions were recorded from the region during the same period. These  results can be interpreted as suggesting that the rate of whitefly borne infection is not always correlated with whitefly abundance,  

2214 |    SORO et al.

FIGURE 4 Maximum-likelihood phylogenetic tree obtained from alignment of partial nucleotide sequences of coat protein (CP) genes  of African cassava mosaic-like viruses (ACMV-like) and East African cassava mosaic-like viruses (EACMV-like). The names of the sequences  characterized in this study are in red. The horizontal scale indicates the genetic distance [Colour figure can be viewed at wileyonlinelibrary. com]

as was recently reported by Eni et al. (2021). Although our results  showed that whiteflies may not be a key factor in the epidemiology  of CMD in our study area, it would be interesting to conduct other  field experiments using CMD-free planting material, in different  localities and at different times of the year, to determine the role  played by whiteflies in CMD epidemiology. 

This study shows the presence of ACMV-like viruses in the eight  cassava-growing regions and EACMV-like viruses in six of them,  occurring as single or mixed infections in CMD-affected cassava  

plants in Burkina Faso. This is probably due to the exchange of  planting material between Burkina Faso and the neighbouring  countries such as Ivory Coast, Togo, and Ghana where ACMV-like  viruses and EACMV-like viruses have been also reported (Adjata  et al., 2009; Torkpo et al., 2017; Toualy et al., 2014). ACMV-like vi 

ruses were the predominant CMGs species in each cassava-growing  region as the majority of CMD resulted from single ACMV-like virus  infections. The predominance of single ACMV-like virus infection in  West Africa has previously been reported (Abubakar et al., 2019;  

   SORO et al. |  2215 

Ogbe et al., 2006; Pita, Fondong, Sangaré, Kokora, et al., 2001;  Toualy et al., 2014) accompanied by a low distribution of EACMV like virus single infections (Ariyo et al., 2005; Ogbe et al., 2006;  Toualy et al., 2014). Our current work confirms that the situation  has not changed. In addition, we discovered that most EACMV like virus isolates occurred as mixed infections with ACMV. Over  86% of the EACMV-like virus positive samples were found to have  East African cassava mosaic Cameroon virus (EACMCMV). These  results show that EACMCMV occurrence may be more prevalent  in Burkina Faso than previously thought. Our analysis confirms that  the CMG isolates obtained from Burkina Faso samples are phyloge netically associated with ACMV-like viruses (ACMV and ACMBFV)  and EACMCMV. We propose further analysis, such as the use of  specific primers for each CMG species or next-generation sequenc ing, to resolve the issue of the occurrence of CMG species and  strains in Burkina Faso. 

We detected the occurrence of CMGs in symptomless samples  (2.1%), which shows that the viruses can be latent in the plants  without manifesting symptoms. Therefore, the use of symptom less cassava landraces as an option to manage CMD could inad vertently result in increased cutting-borne transmission because  they may harbour CMGs. We propose that the use of certified  virus-free cuttings for the establishment of new cassava fields will  be crucial for fighting the transmission of CMD. In the absence  of certified virus-free cuttings, the training of farmers on how to  select healthy cuttings for the new planting season and on use  of in-field diagnostic applications will be crucial to bring down  the incidence or transmission of these viruses of high economic  importance. 

ACKNOWLEDGEMENTS 

This work was supported, in whole or in part, by the Bill & Melinda  Gates Foundation and The United Kingdom Foreign, Commonwealth  & Development Office (FCDO) under grant number OPP1082413 to  the Central and West African Virus Epidemiology (WAVE) Program  for root and tuber crops—through a subgrant from Université Félix  Houphouët-Boigny (UFHB) to the Institut de l’Environnement et de  Recherches Agricoles (INERA). Under the grant conditions of the  Foundation, a Creative Commons Attribution 4.0 Generic License  has already been assigned to the Author Accepted Manuscript ver sion that might arise from this submission. We thank Adja Ndiaye for  reviewing the manuscript. 

CONFLICT OF INTEREST 

The authors declare that they have no conflict of interest. 

DATA AVAILABILITY STATEMENT 

The data that support the findings of this study are available from  the corresponding author upon reasonable request. 

ORCID 

Monique Soro https://orcid.org/0000-0003-0459-5884 Fidèle Tiendrébéogo https://orcid.org/0000-0002-3619-3268 

REFERENCES 

Abubakar, M., Singh, D. & Keta, J.N. (2019) Cassava mosaic disease and  associated geminiviruses in Bauchi state, Nigeria: occurrence and  distribution. American Journal of Plant Biology, 4, 85–90. 

Adjata, K.D., Muller, E., Peterschmi, M., Traore, O. & Gumedzoe, Y.M.D.  (2009) Molecular evidence for the association of a strain of Uganda  variant of East African cassava mosaic virus to symptom severity in  cassava (Manihot esculenta Crantz) fields in Togo. American Journal  of Biochemistry and Biotechnology, 5, 196–201. 

Ally, H.M., Hamss, H.E., Simiand, C., Maruthi, M.N., Colvin, J., Omongo,  C.A. et al. (2019) What has changed in the outbreaking populations  of the severe crop pest whitefly species in cassava in two decades?  Scientific Reports, 9, 14796. 

Ariyo, O.A., Koerbler, M., Dixon, A.G.O., Atiri, G.I. & Winter, S. (2005)  Molecular variability and distribution of cassava mosaic begomovi ruses in Nigeria. Journal of Phytopathology, 153, 226–231. 

Bao, Y., Chetvernin, V. & Tatusova, T. (2014) Improvements to pairwise  sequence comparison (PASC): a genome-based web tool for virus  classification. Archives of Virology, 159, 3293–3304. 

Benjamini, Y. & Yekutieli, D. (2001) The control of the false discovery  rate in multiple testing under dependency. Annals of Statistics, 29,  1165–1188. 

Berrie, L.C., Rybicki, E.P. & Rey, M.E.C. (2001) Complete nucleotide se quence and host range of South African cassava mosaic virus: fur ther evidence for recombination amongst begomoviruses. Journal  of General Virology, 82, 53–58. 

Bock, K.R. & Woods, R.D. (1983) Etiology of African cassava mosaic dis ease. Plant Disease, 67, 994–995. 

Bull, S.E., Briddon, R.W., Sserubombwe, W.S., Ngugi, K., Markham, P.G. &  Stanley, J. (2006) Genetic diversity and phylogeography of cassava  mosaic viruses in Kenya. Journal of General Virology, 87, 3053–3065. 

Byju, G. & Suja, G. (2020) Mineral nutrition of cassava. Advances in  Agronomy, 159, 169–235. 

Chikoti, P.C., Ndunguru, J., Melis, R., Tairo, F., Shanahan, P. & Sseruwagi,  P. (2013) Cassava mosaic disease and associated viruses in  Zambia: occurrence and distribution. International Journal of Pest  Management, 59, 63–72. 

Dabiré, R. & Belem, J. (2003) Les plantes à tubercules et racines au  Burkina Faso. WASNET, 8, 12–16. 

El-Sharkawy, M.A. (2004) Cassava biology and physiology. Plant  Molecular Biology, 56, 481–501. 

Eni, A.O., Efekemo, O.P., Onile-ere, O.A. & Pita, J.S. (2021) South West  and North Central Nigeria: assessment of cassava mosaic disease  and field status of African cassava mosaic virus and East African  cassava mosaic virus. Annals of Applied Biology, 178, 466–479. 

Fondong, V.N., Pita, J.S., Rey, M.E.C., De Kochko, A., Beachy, R.N. &  Fauquet, C.M. (2000) Evidence of synergism between African cas sava mosaic virus and a new double-recombinant geminivirus infect ing cassava in Cameroon. Journal of General Virology, 81, 287–297. 

Guira, F., Some, K., Kabore, D., Sawadogo-Lingani, H., Traore, Y. &  Savadogo, A. (2017) Origins, production, and utilization of cassava  in Burkina Faso, a contribution of a neglected crop to household  food security. Food Science and Nutrition, 5, 415–423. 

Konaté, G., Barro, N., Fargette, D., Swanson, M.M. & Harrison, B.D.  (1995) Occurrence of whitefly-transmitted geminiviruses in crops  in Burkina Faso and their serological detection and differentiation.  Annals of Applied Biology, 126, 121–130. 

Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. (2018) MEGA X: mo lecular evolutionary genetics analysis across computing platforms.  Molecular Biology and Evolution, 35, 1547–1549. 

Legg, J.P., French, R., Rogan, D., Okao-Okuja, G. & Brown, J.K. (2002)  A distinct Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha:  Aleyrodidae) genotype cluster is associated with the epidemic of  severe cassava mosaic virus disease in Uganda. Molecular Ecology,  11, 1219–1229.

2216 |    SORO et al. 

Legg, J.P., Owor, B., Sseruwagi, P. & Ndunguru, J. (2006) Cassava mosaic  virus disease in East and Central Africa: epidemiology and man agement of a regional pandemic. Advances in Virus Research, 67,  355–418. 

MacFadyen, S., Paull, C., Boykin, L.M., De Barro, P., Maruthi, M.N.,  Otim, M. et al. (2018) Cassava whitefly, Bemisia tabaci (Gennadius)  (Hemiptera: Aleyrodidae) in East African farming landscapes: a re view of the factors determining abundance. Bulletin of Entomological  Research, 108, 565–582. 

Maruthi, M.N., Seal, S., Colvin, J., Briddon, R.W. & Bull, S.E. (2004) East  African cassava mosaic Zanzibar virus – a recombinant begomo virus species with a mild phenotype. Archives of Virology, 149,  2365–2377. 

Mugerwa, H., Colvin, J., Alicai, T., Omongo, C.A., Kabaalu, R., Visendi, P.  et al. (2021) Genetic diversity of whitefly (Bemisia spp.) on crop and  uncultivated plants in Uganda: implications for the control of this  devastating pest species complex in Africa. Journal of Pest Science,  94, 1307–1330. 

Mulenga, R.M., Legg, J.P., Ndunguru, J., Miano, D.W., Mutitu, E.W.,  Chikoti, P.C. et al. (2016) Survey, molecular detection, and charac terization of geminiviruses associated with cassava mosaic disease  in Zambia. Plant Disease, 100, 1379–1387. 

Mwatuni, F., Ateka, E., Karanja, L., Mwaura, S. & Obare, I. (2015)  Distribution of cassava mosaic geminiviruses and their associ ated DNA satellites in Kenya. American Journal of Experimental  Agriculture, 9, 1–12. 

Ntawuruhunga, P., Dixon, A.G.O., Kanju, E., Ssemakula, G., Okechukwu,  R.U., Whyte, J.B.A. et al. (2013) Successful innovations and les sons learnt in cassava improvement and deployment by IITA in the  Eastern African Region. African Journal of Root and Tuber Crops, 10,  41–54. 

Ogbe, F.O., Dixon, A.G.O., Hughes, J.D’A., Alabi, O.J. & Okechukwu,  R. (2006) Status of cassava begomoviruses and their new natural  hosts in Nigeria. Plant Disease, 90, 548–553. 

Patil, B.L. & Fauquet, C.M. (2009) Cassava mosaic geminiviruses: ac tual knowledge and perspectives. Molecular Plant Pathology, 10,  685–701. 

Permingeat, H.R., Romagnoli, M.V., Juliana, I. & Vallejos, R.H. (1998) A  simple method for isolating DNA of high yield and quality from cot ton (Gossypium hirsutum L.) leaves. Plant Molecular Biology Reporter,  16, 89. 

Pita, J.S., Fondong, V.N., Sangaré, A., Kokora, R.N.N. & Fauquet, C.M.  (2001) Genomic and biological diversity of the African cassava  geminiviruses. Euphytica, 120, 115–125. 

Pita, J.S., Fondong, V.N., Sangaré, A., Otim-Nape, G.W., Ogwal, S. &  Fauquet, C.M. (2001) Recombination, pseudorecombination and  synergism of geminiviruses are determinant keys to the epidemic  of severe cassava mosaic disease in Uganda. Journal of General  Virology, 82, 655–665. 

Price, M.N., Dehal, P.S. & Arkin, A.P. (2010) FastTree 2 – approximately  maximum-likelihood trees for large alignments. PLoS One, 5, e9490. 

Pushpalatha, R. & Gangadharan, B. (2020) Is cassava (Manihot esculenta Crantz) a climate “smart” crop? A review in the context of bridging  future food demand gap. Tropical Plant Biology, 13, 201–211. 

Saediman, H., Limi, M.A., Rosmawaty, A.P. & Indarsyih, Y. (2016) Cassava  consumption and food security status among cassava growing  households in southeast Sulawesi. Pakistan Journal of Nutrition, 15,  1008–1016. 

Sseruwagi, P., Sserubombwe, W.S., Legg, J.P., Ndunguru, J. & Thresh,  J.M. (2004) Methods of surveying the incidence and severity of  cassava mosaic disease and whitefly vector populations on cassava  in Africa: a review. Virus Research, 100, 129–142. 

Stanley, J. & Gay, M. (1983) Nucleotide sequence of cassava latent virus  DNA. Nature, 301, 260–262. 

Terry, E.R. (1975) Description and evaluation of cassava mosaic disease  in Africa. In: Terry, E.R. & MacIntyre, R. (Eds.) The international ex change and testing of cassava germplasm in Africa. Ibadan, Nigeria:  IITA, pp. 53–54. 

Tiendrébéogo, F., Lefeuvre, P., Hoareau, M., Harimalala, M.A., De Bruyn,  A., Villemot, J. et al. (2012) Evolution of African cassava mosaic  virus by recombination between bipartite and monopartite bego moviruses. Virology Journal, 9, 1–7. 

Tiendrébéogo, F., Lefeuvre, P., Hoareau, M., Traoré, V.S.E., Barro, N.,  Reynaud, B. et al. (2009) Occurrence of East African cassava mo saic virus -Uganda (EACMV-UG) in Burkina Faso. Plant Pathology,  58, 783. 

Torkpo, S.K., Gafni, Y., Danquah, E.Y. & Offei, S.K. (2018) Incidence and  severity of cassava mosaic disease in farmer’s fields in Ghana.  Ghana Journal of Agricultural Science, 53, 61. 

Torkpo, S.K., Offei, K., Danquah, E.Y. & Gafni, Y. (2017) Status of cassava  mosaic begomoviruses in farmers’ fields in Ghana. AIMS Agriculture  and Food, 2, 279–289. 

Toualy, M.N.Y., Akinbade, S.A., Koutoua, S., Diallo, H.A. & Lava, P.K.  (2014) Incidence and distribution of cassava mosaic begomoviruses  in Côte d’Ivoire. International Journal of Agronomy and Agricultural  Research, 4, 131–139. 

Zhou, X., Robinson, D.J. & Harrison, B.D. (1998) Types of variation  in DNA-A among isolates of East African cassava mosaic virus  from Kenya, Malawi and Tanzania. Journal of General Virology, 79,  2835–2840. 

Zinga, I., Chiroleu, F., Legg, J., Lefeuvre, P., Komba, E.K., Semballa, S.  et al. (2013) Epidemiological assessment of cassava mosaic disease  in Central African Republic reveals the importance of mixed viral in fection and poor health of plant cuttings. Crop Protection, 44, 6–12. 

How to cite this article: Soro, M., Tiendrébéogo, F., Pita, J.S.,  Traoré, E.T., Somé, K., Tibiri, E.B., et al (2021) Epidemiological  assessment of cassava mosaic disease in Burkina Faso. Plant  Pathology, 70, 2207–2216. https://doi.org/10.1111/ppa.13459