Cassava Mosaic Virus Disease in Ghana: Distribution and Spread

Oppong et al., J Plant Physiol Pathol 2021, 9:8 

Journal of Plant  

Physiology & Pathology 

Research Article A SciTechnol Journal 

Cassava Mosaic Virus Disease  in Ghana: Distribution and  Spread 

Allen Oppong1*. Ruth Naa A. Prempeh1, Linda Appianimaa  Abrokwah1, Esther Afoley Annang1, Esther Agyeman Marfo1,  Zipporah Appiah Kubi1, Nana A. O. Danquah1, Augustine  Agyekum1, Benedicta Nsiah Frimpong1, Andrews Sarkodie  Appiah3, Joseph N.L. Lamptey1, Moses Brandford Mochiah1,  Justin S. Pita2 

Abstract 

Cassava is an important staple crop in most of the tropics, including  Ghana. The productivity of the crop is beset with pest and disease  attacks. With the emergence of virulent strains of the cassava  mosaic virus (CMV), regular surveys are necessary to ascertain the  prevalence of CMV and their whitefy vectors in farmers’ felds to  help manage CMV disease affecting the crop. Field surveys were  conducted in September and October of 2015 and December 2016  to January 2017 using a harmonized sampling protocol developed  by the West African Virus Epidemiology (WAVE) for root and  tuber projects. Three hundred and ninety-three felds were visited  throughout Ghana and 11,760 cassava leaf samples examined.  Whitefies were counted on 5 plants/feld. Diseased samples with  varying symptoms collected were assayed using PCR and genomic  sequencing. Cassava mosaic disease (CMD) symptoms were  recorded in about ninety-six percent (96.4%) of felds surveyed  with varying severity. These symptoms included leaf mosaic, leaf  distortion/twisting, malformation, fliform leaves, stunting and  chlorosis. Cultivars with red petiole colour were the most prevalent  while those with green petiole colour were the least. No whitefy was  found on cultivars with purple and Green petioles while cultivars  with reddish-green petioles had highest count of whitefies/plant.  The Upper West and Upper East regions had the least amount  of whitefies/plant. The Ghanaian isolates clustered with the East  African cassava mosaic Cameroon virus (EACMCV) isolates in a  cluster analysis. BLASTn analysis of 513 bp fragment of the DNA-B of  Ghanaian isolate GH07216 showed 89.9% similarity with EACMCV Ghana isolates and 90.54% identity with the EACMCV-Ivory Coast.  Similarly, the Ghanaian isolate GH07216 showed 95.8% nucleotide  sequence identity to the EACMCV-Ghana isolate and 94.22% to  the EACMV-Ivory Coast isolate. Nucleotide sequences of DNA-A of  the Ghanaian isolates were less variable: between 95.90-96.73%  when compared to already published sequences to a range of CMG  sequences available on the GenBank. The study has updated the  existing literature on CMD incidence which can contribute to the  development CMD-resistant cassava varieties in Ghana.  

Keywords: Manihot esculenta; EACMV-Ivory coast  

*Corresponding author: Allen Oppong, CSIR-Crops Research Institute, Kumasi,  E-mail: alnopp@yahoo.co.uk  

Received: June 29, 2021 Accepted: July 10, 2021 Published: July 17, 2021 

Introduction 

Cassava is the number one root and tuber crop in Ghana (Figure  1). Te crop is cultivated predominantly in the southern and central  parts of Ghana with signifcant production in the middle and northern  parts of the country. Te only areas of the country which do not have  signifcant production of cassava are the Sudan savannah areas around  the Upper East and North East regions (Figure 1). Te estimated total  land under cassava production is estimated around 900,000 hectares.  In Ghana, over 70% of farmers engage in cassava production, and the  sector contributes about 22% of Agricultural GDP [1]. Ghana ranks  among the top fve cassava producers in Africa with an annual average  production of sixteen million metric tons [1]. 

Its cultivation and associated businesses along the value chain is  a major source of employment for millions of the population. It is  a staple food crop in areas where it is cultivated and it is processed  into several industrial products such as cassava starch, cassava beer,  spray starch, pharmaceutical raw material among several others [2].  In recent times cassava has become an important crop to the socio 

cultural life and the economy of Ghana. However, the production of  this crop faces several challenges. Tese include dependence on low  yielding varieties, poor agronomic practices on the part of farmers  and incidence of pests and diseases [3]. Tere are several pests and  diseases that afect cassava production, but Cassava Mosaic Disease  (CMD) constitutes the most endemic disease of the crop in Ghana  [4]. Te disease can cause yield losses of over 90% depending on time  of infection and the variety [5,6]. Te disease was frst reported in the  country a century ago by Warburg (1894) who described it as ‘leaf  curl’ or ‘crinkle’ illness aficting cassava plants” [7, 8]. Several strains  of the cassava mosaic virus, the causal agent of CMD, have been  reported in Ghana and in other parts of Africa and have been shown  to be responsible for severe yield losses [9-15].  

To ascertain the current distribution of CMD and the strain  diversity of the virus in Ghana it is important that periodic surveys  and feld monitoring are conducted. Tis approach can help develop  strategies which can curtail the potential damage that new and more  virulent strains of the virus could cause to cassava production in the  country and beyond.  

To this end, two nationwide surveys were conducted to provide  baseline data that can be used by breeders and other stakeholders,  including modelers, to identify disease hotspot and cold spots for  breeding resistant varieties and the multiplication of disease-free  planting materials for farmers. Additionally, this would provide data  for predicting the rate of spread of cassava mosaic virus in Ghana and  West Africa.  

Materials and Methods 

Field survey 

Surveys were conducted throughout the regions indicated in  (Figure 1). Tey were carried out in September and October of 2015  and December 2016 to January 2017, using a harmonized sampling  protocol developed by the West African Virus Epidemiology (WAVE)  for root and tuber project head quartered at the University of Félix  Houphouët-Boigny, Abidjan, Côte d’Ivoire. During each survey, 

All articles published in Journal of Plant Physiology & Pathology are the property of SciTechnol, and is protected by copyright  laws. Copyright © 2021, SciTechnol, All Rights Reserved. International Publisher of Science,  

Technology and Medicine 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Figure 1: Map of Ghana showing regional boundaries and the agro-ecologies.

coordinates of felds visited were captured using a GPS device. Te  minimum distance between two felds where samples were collected  was 10 km and in areas where cassava production was sparse,  the distance between two felds varied depending on minimum  distances felds were encountered. In each feld transect walks  along two diagonals were made, and disease incidence and severity  were assessed on 15 plants within each transect. Tus, a total of 30  plants were assessed in each feld for disease incidence and severity.  Disease incidence was measured as a percentage of number of plants  infected per feld based on the sampled plants while disease severity  was assessed based on a scale ranging from 1 to 5 as defned by the  International Institute of Tropical Agriculture (IITA). Using this  scale, 1 represents absence of infection; 2: mild infection; 3: moderate  infection; 4: severe infection and 5 represents very severe infection  [16]. Data were collected via an electronic device programmed by the  University of Cambridge, UK. Te data were then uploaded into a  central repository at the University of Cambridge, UK for analysis.  From each feld, leaf samples showing symptoms of cassava mosaic  virus infection were collected from among the top 5 leaves; these were  kept in herbarium pressers and labeled. In addition, stem cuttings  of infected plants were also collected and labeled. Te leaf samples  were stored at the laboratory under ambient conditions while the  stem cuttings were maintained in insect proof screenhouse prior to  laboratory analysis. Whitefy Bemisia tabaci vectors were collected  using an aspirator from 5 plants/feld and the total number counted  and recorded. Te whitefies were preserved in 70% ethanol, labeled  and stored at the laboratory in a freezer at 4°C. Te diversity of cassava  genotypes encountered on the felds were diferentiated using the leaf  petiole colour as most of the farm owners could not readily give the  names of the varieties they had planted. 

Laboratory diagnostics  

Genomic DNA was extracted from samples based on Cetyl  Trimethyl Ammonium Bromide (CTAB) method [17].  

Polymerase chain reaction (PCR) 

PCR was carried out in a 25 µl reaction consisting of the following  

reagents: PCR-grade water; 5 µl of 5x standard bufer; 2.5 µl 5%  Tween-20; 0.25 µl of 10 mM dNTPs; 0.25 µl each of Forward and  Reverse primers; 5 U Taq polymerase and 5 µl of DNA template.  (Table 1) contains the list of primers used for the analysis and  detection of virus strains. 

Termocycling conditions 

Amplification conditions included a first PCR cycle comprising  denaturation at 94°C for 5 min, annealing of primers at 52°C for 1  min and elongation at 72°C for 2 min. Tis initial amplification cycle  was followed by 35 cycles of 1 min at 94°C, 1 min at 52°C and 2 min at  72°C. At the end of the reaction, a final elongation step was achieved  at 72°C for 10 min and the reaction held at 4°C.  

PCR products were separated by electrophoresis on a 1.5%  agarose gel containing ethidium bromide (1 lg⁄10 ml) under a constant  current of 100 V. Visualization of the amplified bands under UV light  was done using a Vilber Lourmat (InfnityTM) gel documentation  imaging system. 

Sequencing 

Where the expected bands on the agarose gel were not at exactly  at the position according to the primer base pair, the recovered PCR  products were prepared for sequencing. Sequencing was carried out  by GENEWIZ, Inc (South Plainfeld, NJ) using Applied Biosystems  Big Dye version 3.1. Te reactions were then run through an Applied  Biosystem 3730xl DNA Analyzer for DNA sequencing. 

Data analysis 

For our analysis, we made use of data-analysis sofware, namely  a multi-dimensional data cube referred to, within the WAVE  programme as Scriptoria (2021); as the WAVE Cube. Tis tool  enabled us to interrogate and view our survey data from diferent  perspectives to present our extracted results as tables and graphics. 

Sequence analysis 

Te sequence data was analysed by frst checking the  

Volume 9 • Issue 8 • 1000258 • Page 2 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Table 1: Primers used in this study to amplify DNA from cassava samples collected during disease survey. 

Primer Name  Sequences (5’ to 3’)  Virus Species  Product Size (bp)
JSP001F/ 

JSP002R

ATGTCGAAGCGACCAGGAGAT 

TGTTTATTAATTGCCAATACT

ACMV  ̴ 770
JSP001F  ATGTCGGAAGCGACCAGGAGAT  EACMV  ̴ 770
JSP003R  CCTTTATTAATTTGTCACTGC  EACMV
CMBRep/F  CRTCAATGACGTTGTACCA  ACMV  368
ACMVRep/R  CAGCGGMAGTAAGTCMGA  ACMV
CMBCP/F  GKCGAAGCGACCAGGAGAT  ACMV  650
ACMVCP/R  CCCTGYCTCCTGATGATTATA  ACMV
ACMV-AL1/F  GCGGAATCCCTAACATTATC  ACMV  1000
ACMV-ARO/R  GCTCGTATGTATCCTCTAAGGCCTG  ACMV
UV-AL1/F1  TGTCTTCTGGGACTTGTGTG  EACMV  1600
UV-AL1/R1  AACCTATCCCCGATGCTCAT  EACMV
UV-AL1/F2  GTAATTGGGAAAGGGCCTCT  EACMV  1000
UV-CP/R  GTTACGGAGCAACATGCAAT  EACMV
UV-AL1/F1  TGTCTTCTGGGACTTGTGTG  EACMV-UG  1600
ACMV-CP/R3  TGCCTCCTGATGATTATATGTC  EACMV-UG
CMBCP/F  GKCGAAGCGACCAGGAGAT  EACMV-UG  1000
EACMV-UG/R  CGCCTAAGCAAGGAATGGCGT  EACMV-UG
ACMVB1F  TCGGGAGTGATACATGCGAAGGC  ACMV 628 
ACMVB2R  GGCTACACCAGCTACCTGAAGCT  ACMV
VNF031/F  GGATACAGATAGGGTTCCCAC  EACMV  ≈ 560
VNF032/R  GACGAGGACAAGAATTCCAAT  EACMV
EAB555/F  TACATCGGCCTTTGAGTCGCATGG  EACMV  544-560
EAB555/R  CTTATTAACGCCTATATAAACACC  EACMV

 

chromatograms manually to avoid base miscalls and then trimmed  of low-quality sequences at the 5′ and 3′ ends. Te forward and  reverse sequences were compared to ensure complete homology.  Te sequences were then edited, aligned and compared with other  published isolates using Geneious 8.0 (Biomatters), ClustalW [18]  BLAST [19]. Te nucleotide sequences derived from each of the CMG  isolates from Ghana were used in BLASTn analysis to ascertain their  identity to the published isolates deposited at the NCBI database.  Cluster dendrograms were generated with the Geneious Tree Builder  using the Neighbor-joining method with 1000 bootstrap support. 

Results 

Field survey 

Tree hundred and ninety-three (393) cassava farms were  surveyed (215 in 2015 and 178 in 2016/17); in total 11,790 plants were  examined across the country. Over ninety-six percent (96.44%) of  all felds surveyed were diagnosed with CMD (Table 2) showing the  endemic nature of CMD in Ghana.  

Northern region had the highest incidence of CMD followed by  Brong-Ahafo and the Upper West regions respectively (Figure 2)  while Greater Accra had the highest CMD severity followed by Upper  West, Ashanti, Eastern, Western and then Brong-Ahafo regions  (Figures 3-5). 

CMD Symptoms regularly encountered include leaf mosaic,  leaf distortion/twisting, malformation, fliform leaves and stunting  (Figure 6). 

Fields with 50% to 75% disease incidence had the highest number  of whitefy populations while those with disease incidence greater  than 75% had the least whitefy population (Figure 7). Ashanti region  had the highest whitefy population/plant followed by Central and the  

Table 2: Percentage of cassava felds showing CMD-infected and non-infected. 

Year of Survey  CMD-Infected Fields %  Healthy Fields %
2015 (Year 1)  95.35%  4.65%
2016/17 (Year 2)  97.75%  2.25%
Grand Total  96.44%  3.56%

 

Table 3: Mean Whitefy population count per plant across the regions during the  2-year survey period.

Region  Whitefy – Mean population/plant
Ashanti  2.11
Brong-Ahafo  0.85
Central  1.38
Eastern  0.85
Greater Accra  0.72
Northern  0.12
Upper East  0.05
Upper West  0.07
Volta  0.75
Western  1.66
Mean  1.03

 

Western regions respectively (Table 3). 

Dominant varieties encountered were cultivars with red petioles  followed by those with yellowish green petiole (Table 4 and Figure 6).  However, farmers could not identify the varieties by their actual names  and most of them classifed the plants as local varieties. Varieties with  yellowish green petioles had the highest disease severity, followed  by varieties with red petioles while plants with yellowish green  petioles with pinkish colouration had the lowest severity (Table 4).  No whitefies were collected on plants with purple and green petioles  encountered during the feld surveys (Table 4). 

Volume 9 • Issue 8 • 1000258 • Page 3 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Laboratory diagnostics 

Figure 2: Percentage mean incidence of CMD across the regions surveyed in 2015 and 2016/17. 

Figure 3: Mean severity of CMD disease across the regions during the 2015 and 2016/17 surveys. 

Figure 4: Map showing the incidence (A) and severity (B) of CMD in Ghana for 2015.

sequences available on the NCBI. Te Ghanaian isolates clustered  

Afer trimming, sequences of 513 nt of CMG DNA-B of the  Ghanaian isolates were compared to a range of CMG DNA-B  

with full genomes of the East African cassava mosaic Cameroon  virus (EACMCV) isolates as indicated in the cluster dendrogram  illustrated in (Figures 8 and 9) indicating the sequenced nucleotides  

Volume 9 • Issue 8 • 1000258 • Page 4 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Figure 5: Map showing CMD severity (A) and incidence (B) of areas surveyed in 2016/17. 

Figure 6: CMD symptoms on infected plants encountered during the survey. The arrows point to A: Leaf mosaic/distortion, B:  Filiforms and C: Stunting/leaf mosaic/distortion and some of leaf petiole colours observed. 

Figure 7: Mean CMD percentage incidence and mean whitefy number in felds surveyed over the two-year period. 

from our samples although complete shared close resemblance.  BLASTn analysis of 513 bp fragment of the DNA-B of Ghanaian  isolate GH07216 showed 89.9% similarity with EACMCV-Ghana  isolate (Accession no, JN165087.1) and 90.54% identity with the  EACMCV-Ivory Coast (Accession no, AF259897.1) (Figure 8).  

Similarly, Ghanaian isolate GH07216 showed 95.8% nucleotide  sequence identity to the EACMCV-Ghana isolate and 94.22% to the  Ivory Coast isolate. Nucleotide sequences of DNA-A of the Ghanaian  isolates were less variable when compared to already published  sequences available on the GenBank. BLAST analysis of a 747 bp 

Volume 9 • Issue 8 • 1000258 • Page 5 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Table 4: Cultivar petiole colour, CMD severity and whitefy population count per plant observed during the survey period. 

Cultivar type (Petiole colour)  No. of samples  CMD Severity Mean  Whitefy count  Whitefy count/plant
Reddish green  30  2.67  29.00 (0.5392)  0.86
Pinkish petiole  330  2.82  15.00 (0.0084)  0.04
Purple petiole  30  2.33  0.00 (0.0000)  0
Red petiole  8,250  2.98  1,974.00 (0.0398)  0.34
Yellowish green petiole  3,030  2.99  729.00 (0.0523)  0.24
Greenish red Petiole  30  2.00  6.00 (0.1390)  0.2
Green petiole  60  2.78  0.00 (0.0000)  0
Total  11,760  2.98  2,753.00 (0.0266)
*Numbers in brackets are standard error of mean (SEM) values

 

Figure 8: Dendrogram showing clustering of samples with similar DNA-A nucleotide patterns, this clustering was produced  using Geneious Tree Builder using the Neighbour-joining method with 1000 bootstrap support. The Ghanaian isolate clustered  together with 84.4% similarity to ACMV isolates including ACMV KE and ACMV Ghana isolates.

fragment of isolate Gh14916 revealed nucleotide sequence identity of  between 95.90-96.73 % to a range of CMG sequences available on the  GenBank (Figure 9). 

Discussion 

Te fndings of this survey on the incidence and spread of CMD  are similar to those reported by [20,21] although their surveys were  limited to certain parts of Ghana. Te inclusion of the northern parts  of the country in our current surveys is relevant. Similar surveys done  in the past have ofen focused mainly on the southern parts [21]. In the  most recent survey of the country carried out by [21] in 2007 and 2008,  they reported the widespread incidence of CMD in mainly southern  and central parts of Ghana and they surveyed only 136 farmers’ felds,  but our work has gone beyond these geographical areas and numbers.  

Te current study represents a large increase in the number of felds  surveyed in recent times and gives a better picture of the extent of  spread of CMD in Ghana. Tis result also gives indication as to the  levels of productivity lost by farmers, assuming a 10% yield reduction  to CMD infection on farmer felds. Tis fnding requires that urgent  steps be taken to fnd a robust remedy to reduce the incidence of  CMD in farmers’ felds to improve cassava productivity and ensure  food security because cassava alone contributes about 22% of Ghana’s  agricultural GDP. 

Te CMD symptoms observed is consistent with CMD symptoms  reported by several authors including all [20-22].  

Te low incidence of whitefies on plants showing very high  incidence of CMD (75% to 100%) suggests that the highly infected  

Volume 9 • Issue 8 • 1000258 • Page 6 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

Figure 9: Dendrogram showing clustering of samples with similar DNA-B nucleotide patterns. this clustering was produced  using Geneious Tree Builder using the Neighbour-joining method with 1000 bootstrap support Four of the Ghanaian isolates  clustered with EACMVCV-Ivory Coast isolate and others

felds become unattractive to the insects and therefore the insects  move on to felds that are fresher and healthier or possibly younger  [23]. Te studies by them [24] have reported that the disease  incidence on felds planted with infected cuttings and the relative  abundance of whitefies contribute diferently to the incidence of the  disease. Analysis of symptoms observed on infected plants and felds  during our survey indicated that infections could be from infected  cuttings used as planting materials as well as from whitefies. Tese  two sources have been established as key sources of infections and it  is believed that both infected cuttings and whitefies afected disease  incidence and severity in the felds surveyed [25].  

Generally, the whitefy populations encountered in the felds  were low and varied among the regions; this is similar to fndings  by [26] in Congo Brazzaville and [27] in Ghana. Te northern  parts of Ghana which have a savannah agro-ecology with unimodal  rainfall had the lowest incidence of whitefies which is similar to  observations reported. Te northern parts of Ghana can be proposed  for the establishment and maintenance of clean planting materials  production felds. Tis is because with low incidence of whitefies it  is expected that felds planted with disease-free cuttings can maintain  their health status for some time before they become infected. 

Laboratory diagnostics 

Te detection of various strains of ACMV and EACMCV isolates  based on the analysis of CMV DNA-A and DNA-B nucleotides shows  the widespread nature of CMVs in Ghana. Previous reports had  detected ACMV-Ghana isolate and EACMV-Cameroun and others.  

However, the detection of ACMV isolate with 84.4% similarity to  ACMV-Kenya isolate and EACMVCV Ivory Coast isolate in the  present study for instance is a clear indication that more strains of  CMV could be present already in Ghana or new strains of CMV  could be entering the country. It is therefore important that regular  monitoring and surveillance are conducted to identify any potential  new strains to assist the management of CMD, including breeding  for robust CMV-resistant cultivars thereby improving cassava  productivity. Te possible detection of new strains from regular  monitoring and surveillance can also help modelers to predict the  spread of new strains of CMV and other cassava viruses in the country  and possibly in the West African sub region. 

Conclusion 

While this study has not included a study of the evolutionary  aspects of any of the cassava viruses, it has shown an increase from  previous surveys in the number of viruses detected in Ghana. In  particular, the presence of ACMV-Kenya and EACMV-Ivory Coast  had not been evident previously in Ghana this is therefore a new  fnding for this country. 

Te study has shown the spread and distribution of CMD in  Ghana. Disease symptoms regularly encountered in farmers feld  included leaf mosaic, leaf distortion/twisting, malformation, fliform  leaves, stunting and chlorosis. Cultivars with red petiole colour  were the most prevalent while those with green petiole colour were  the least. No whitefy was found on cultivars with purple and green  petioles while cultivars with reddish-green petioles had highest count  

Volume 9 • Issue 8 • 1000258 • Page 7 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

of whitefies/plant. Te Upper West and Upper East regions had  the least number of whitefies/plant and could be good locations for  healthy planting material production. Te Ghanaian isolates clustered  with the East African Cassava Mosaic Cameroon Virus (EACMCV)  isolates. BLAST analysis of 513 bp fragment of the DNA-B of  Ghanaian isolate GH07216 showed 89.9% similarity with EACMCV 

Ghana isolates and 90.54% identity with the EACMCV-Ivory Coast.  Similarly, Ghanaian isolate GH07216 showed 95.8% nucleotide  sequence identity to the EACMCV-Ghana isolate and 94.22% to the  Ivory Coast isolate. Nucleotide sequences of DNA-A of the Ghanaian  isolates were less variable; between 95.90 – 96.73 % when compared to  already published sequences to a range of CMG sequences available  on the GenBank. Locations with high CMD incidence and severity  were identifed which are good and can be proposed for breeding  of CMD resistant cassava cultivars in the country. Te information  contained in this paper will provide a useful guide for Scientists and  other researchers and Extension worker engaged in cassava research  and improvement of farmer productivity. Using the methodology  shown in this study, we conclude that the possible detection of new  strains from regular monitoring and surveillance could help modelers  to predict entrance of new strains of CMV and other cassava viruses  in the country and possibly in the West African sub region. 

Declaration Section 

Ethics approval and consent to participate 

Not applicable 

Consent of Publication 

Not applicable 

Availability of Data and Material 

Field and laboratory data are stored at the repository of Scriptoria  Agshare,Today, UK and is readily available to interested parties.  

Competing Interests 

Te authors declare that “they have no competing interests”. Funding 

Tis work was funded by the Gates Foundation and UK  Department for International Development (DFID) through  University of Félix Houphouët-Boigny and the WAVE project  (OPP1082413). 

Author’s Contributions 

Allen Oppong: Lead investigator and lead author of this article. 

Ruth N.A Prempeh, Linda A. Abrokwah, Supported data entry,  laboratory analysis and writing of article. 

Esther Afoley Annang, Esther Agyeman Marfo, Zipporah Appiah  Kubi, Supported laboratory analysis and proof reading of article. 

Nana A.O. Danquah Supported in laboratory analysis. Augustine Agyekum Assisted in feld survey and collection of data. Andrews Sarkodie Appiah Assisted in phylogenetic analysis. 

Benedicta Nsiah Frimpong, Joseph N.L. Lamptey, Moses  Brandford Mochiah, Assisted in manuscript review. 

Justin S. Pita Conceptualization of project idea and main  recipient of project grant; review of manuscript. 

Acknowledgement 

The authors are very grateful frstly to the Gates Foundation and UK  Department for International Development (DFID) through University of Félix  Houphouët-Boigny and the WAVE project (OPP1082413) for providing funds for  this work. The authors are also grateful to the various Agric Extension Offcers  who assisted during the feld surveys. The drivers, Technicians and staff of CSIR 

Crops Research Institute who played various roles during the survey are deeply  appreciated. Finally, we thank the Scriptoria AgShare. Today programme and the  University of Cambridge, UK for the editorial and technical support respectively. 

“This work was supported, in whole or in part, by the Bill & Melinda Gates  Foundation [OPP1082413]. Under the grant conditions of the Foundation, a  Creative Commons Attribution 4.0 Generic License has already been assigned  to the Author Accepted Manuscript version that might arise from this submission.” 

References 

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipmon DJ (1990) Basic local  alignment search tool. J Mol Biol 215: 403–410. 
  2. Bisimwa E, Walangululu J, Bragard C (2015) Cassava Mosaic Disease Yield  Loss Assessment under Various Altitude Agroecosystems in the SudKivu  Region, Democratic Republic of Congo. Tropicultura 33: 101110. 
  3. Bock KR (1983) Epidemiology of cassava mosaic disease in Kenya. In:  Plumb RT, Thresh JM, ed. Plant Virus Epidemiology. The Spread and  Control of Insect-borne Viruses. Oxford, United Kingdom: Blackwell Scientifc  Publications, 337-347. 
  4. Bull SE, Briddon RW, Sserubombwe WS, Ngugi K, Markham PG, et al.  (2006) Genetic diversity and phylogeography of cassava mosaic viruses in  Kenya. J Gen Virol 87: 3053-3065. 
  5. Cudjoe A, Gyamenah J, Braima J (2005) Chapter 1.2 (Ghana) In: Whitefies  and whitefy-borne viruses in the tropics: Building a knowledge base for global  action. PK Anderson, FJ Morales, AL Jones and Markham RH (eds) Arte  Libro Impresores, Cali Colombia pp. 24-25.  
  6. Dellaporta SL, Woods J, Hicks JB (1983) A plant DNA mini preparation:  version II. Plant Mol Biol Rep 1: 19-21.  
  7. Fargette D, Fauquet C, Grenier E, Thresh JM (1990) The spread of African  cassava mosaic virus into and within cassava felds. J Phytopathol 130: 289- 302. 
  8. Fauquet C, Fargette D (1990). African cassava mosaic virus: etiology,  epidemiology, and control. Plant Disease 74: 404-411.  
  9. Fondong VN, Pita JS, Rey MEC, Kochko Ade, Beachy RN, et al. (2000)  Evidence of synergism between African cassava mosaic virus and a new  double-recombinant geminivirus infecting cassava in Cameroon. J Gen Virol  81: 287-297.  
  10. Ghana Export Promotion Council (GEPA): https://www.gepaghana.org/ import/ghana-product/cassava-from-ghana/). 
  11. http://www.fao.org/3/x5032e/x5032e06.htm (accessed July 2020). 
  12. International Institute of Tropical Agriculture (IITA), 1990. Cassava in Tropical  Africa: A reference manual. Ibadan, Nigeria. pp. 61-63. 
  13. Koros JC, Runo SM, Yusuf M, Orek CO (2018) Screening Selected Cassava  Cultivars for Resistance against Cassava Viruses and Cassava Green Mites  under Advanced Yield Trials in Kenya. IOSR J Biotechnol Biochem (IOSR JBB) 4: 37-52.  
  14. Legg JP, Owor B, Sseruwagi P, Ndunguru J (2006) Cassava mosaic virus  disease in east and central Africa: epidemiology and management of a  regional pandemic. Advances in Virus Research 67: 355-418. 
  15. Kemausuor F, Akowuah JO, Ofori E (2013) Assessment of Feedstock Options  for Biofuels Production in Ghana. J Sustain Bioenergy Syst 3: 119-128.  
  16. Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular  Evolutionary Genetics Analysis across computing platforms. Molecular  Biology and Evolution 35: 1547-1549. 
  17. Ntawuruhunga P, Okao-Okuja G, Bembe A, Obamb M, Armand Mvila JC, et 

Volume 9 • Issue 8 • 1000258 • Page 8 of 9 • 

Citation: Oppong A, Prempeh RNA, Abrokwah LA, Annang EA, Marfo EA, et al. (2021) Cassava Mosaic Virus Disease in Ghana: Distribution and Spread. J  Plant Physiol Pathol 9:8. 258. 

  1. (2007) Incidence and severity of cassava mosaic disease in the Republic  of Congo. Afr Crop Sci J 15: 1-9.  
  2. Ogbe FO, Dixon AGO, Hughes J d’A, Alabi OJ, Okechukwu, R (2006) Status  of cassava begomo viruses and their new natural hosts in Nigeria. Plant  Disease 90: 548-553.  
  3. Ogbe FO, Thottappilly G, Dixon AGO, Atiri GI, Mignouna HD (2003) Variants  of East African cassava mosaic virus and its distribution in double infections  with African cassava mosaic virus in Nigeria. Plant Disease 87: 229-232.  
  4. Oteng-Frimpong R, Levy Y, Torkpo SK, Danquah EY, Offei SK, et al. (2012)  Complete Genome Sequencing of Two Causative Viruses of Cassava Mosaic  Disease in Ghana. Acta Virol 56: 305-314.  
  5. Owor B, Legg JP, Okao-Okuja G, Obonyo R, Ogenga-Latigo MW (2004) The  effect of cassava mosaic geminiviruses on symptom severity, growth and  root yield of a cassava mosaic virus disease-susceptible cultivar in Uganda.  Annals of Applied Biology, 145: 331-337. 
  6. Page RD (1996) TreeView: an application to display phylogenetic trees on  personal computers. Comput Appl Biosci 12: 357–358. 
  7. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the  sensitivity of progressive multiple sequence alignment through sequence  weighting, position- specifc gap penalties and weight matrix choice. Nucleic  Acids Res 22: 4673–4680. 
  8. Thresh JM, Cooter RJ (2005) Strategies for controlling cassava mosaic virus  disease in Africa. Plant Pathology 54: 587-614. 
  9. Tiendrébéogo F, Lefeuvre P, Hoareau M, Harimalala MA, De Bruyn A, et al.  (2012) Evolution of African cassava mosaic virus by recombination between  bipartite and monopartite begomo viruses Virol J 9: 67. 
  10. Torkpo SK, Offei K, Danquah EY, Gafni Y (2017) Status of Cassava mosaic  begomo viruses in farmers’ felds in Ghana. AIMS Agriculture and Food 2:  279-289. 
  11. Warburg O (1984) (Die kulturpfanzen usambaras) Mittcilungenaus den  Deutschen Schutzgebieten 7: 131. 

Author Affliations  

1CSIR-Crops Research Institute, Kumasi 

2Université Félix Houphouët-Boigny Abidjan, Côte d’Ivoire 

3Biotechnology and Nuclear Agricultural Research Institute, Kwabenya, Accra 

Volume 9 • Issue 8 • 1000258 • Page 9 of 9 • View publication stats